Home Page Link AgBioWorld Home Page
About AgBioWorld Donations Ag-Biotech News Declaration Supporting Agricultural Biotechnology Ag-biotech Info Experts on Agricultural Biotechnology Contact Links Subscribe to AgBioView Home Page

AgBioView Archives

A daily collection of news and commentaries on
ag-biotech.


Subscribe AgBioView Subscribe

Search AgBioWorld Search

AgBioView Archives

Subscribe

 


SEARCH:     

Date:

March 28, 2005

Subject:

GM golden rice boosts vitamin A; Improving the nutritional value of Golden Rice through increased pro-vitamin A content; Science vs. Culture in Mexico's Corn Staple

 

Today in AgBioView from www.agbioworld.org : March 28, 2005

* GM golden rice boosts vitamin A
* New 'golden rice' carries far more vitamin
* STATEMENT FROM THE GOLDEN RICE HUMANITARIAN BOARD
* Improving the nutritional value of Golden Rice through increased pro-vitamin A content
* Nature and GM crops
* Table talk
* NU-Monsanto seed deal criticized
* GM minutiae
* Food fight - Conntribution of biotech crops to European competitiveness
* Need for infrastructure to test imported GM food - government
* Science vs. Culture in Mexico's Corn Staple
* Named: the farmers who make hay by handouts
*****************************

http://news.bbc.co.uk/1/hi/sci/tech/4386933.stm

GM golden rice boosts vitamin A

- BBC NEWS, By Richard Black, 28 March 2005

UK scientists have developed a new genetically-modified strain of "golden rice", producing more beta-carotene.

The human body converts beta-carotene into vitamin A, and this strain produces around 20 times as much as previous varieties.

It could help reduce vitamin A deficiency and childhood blindness in developing countries.

The World Health Organisation estimates up to 500,000 children go blind each year because of vitamin A deficiency.

When the original strain of golden rice emerged from laboratories in Switzerland five years ago, it was hailed by some as an instant solution.

But that original strain didn't produce enough beta-carotene to ensure that children would get their daily requirement from eating normal quantities of rice.

And because of concerns about GM agriculture, it still has not been grown in field trials in Asia.

The new variety, developed at the UK laboratories of the biotechnology company Syngenta, produces much more beta-carotene.

Syngenta is making the rice available for free to research centres across Asia, who will, if they are given the go-ahead by their governments, begin field trials.

Not everyone believes golden rice is the best answer to Vitamin A deficiency.

Some agricultural experts and environmental groups say aiming for a balanced diet across the board would be a better solution.

But it is the first concrete evidence that GM technology can produce crops aimed at solving the pressing problems of the developing world, rather than increasing the profits of western biotechnology companies.
*********************************

http://www.newscientist.com/article.ns?id=dn7196

New 'golden rice' carries far more vitamin

- NEW SCIENTIST, By Andy Coghlan, 27 March 2005

Claims that genetically engineered "golden rice" can help prevent blindness by boosting vitamin A intake have been bolstered by a new strain.

Compared with the original golden rice unveiled in 2000, "Golden rice 2" contains up to 23 times more provitamin A, the substance converted in the body into vitamin A. This vitamin is vital for preventing childhood blindness, which affects 500,000 children worldwide each year.

The breakthrough was achieved by replacing a gene originally borrowed from daffodils, and which also has a counterpart from maize. "We found it made a dramatic difference - a 20-fold increase," says Rachel Drake, head of the team at Syngenta Seeds in Cambridge, UK, which developed the new strain.

"I'm absolutely delighted, and I think it's a very compelling story," says Drake, whose team developed the new strain for the Humanitarian Rice Board which runs the golden rice project at the University of Freiburg in Germany.

Practical proposition

Critics of the original golden rice said that its levels of provitamin A - 1.6 micrograms per gram of rice - were too low to make the rice a practical proposition. But each gram of the new strain contains up to 37 micrograms of the provitamin.

Drake estimates conservatively that the rice could provide at least half what a child would need. But Jorge Mayer, golden rice project manager in Freiburg, is even more upbeat, saying the rice might now contain enough to supply the entire recommended daily intake.

But critics point out that it remains to be proven that the provitamin A is absorbed and converted into vitamin A when people eat the rice. They see the project as little more than a public relations exercise to soften up consumer opposition to GM foods.

"There are still lots of unanswered questions," says Christoph Then, Greenpeace's genetic engineering spokesman. "Even after five years of study, the researchers don't know how much provitamin A is left when the rice is cooked. And no risk assessments for the environment or human health have been performed."

Mayer says that questions about the uptake of provitamin A, also known as beta carotene, could be answered later in 2005 through feeding experiments in people using the original golden rice.

Coming up trumps

To ramp up the levels of provitamin A, Drake and her colleagues scrutinised the original golden rice plants, which contained two extra genes. One, called phytoene synthase, had been taken from daffodils. The other, called carotone synthetase 1, came from the soil bacterium, Erwinia uredovora.

She discovered that the enzyme made by the phytoene synthase was the "bottleneck" in production. When she tried counterpart genes from other plants to see if they worked better in the rice, the gene from maize came up trumps.

Syngenta owns golden rice 2, but is donating it to the Humanitarian Rice Board. Mayer says that permits have now been received allowing planting of the rice in India and the Philippines, two countries where the rice could have a real impact.
*************************************

STATEMENT FROM THE GOLDEN RICE HUMANITARIAN BOARD

For further information, contact:
Dr Jorge Mayer, +49 (761) 203 4986,
mobile +49 (176) 2421 0958
email: jorge.mayer@ctf.uni-freiburg.de

Dr Gurdev Khush +1 (530) 750 2440
Dr Gerard Barry (IRRI) +63 (917) 544 6835

On Development of New Golden Rice Strain with Higher Levels of Beta-Carotene

The Golden Rice Humanitarian Board welcomes the peer reviewed study published in the April issue of Nature Biotechnology detailing the development of a new variety of Golden Rice that contains approximately 23 times more beta-carotene or "pro-vitamin A" than the original Golden Rice variety. The human body converts beta-carotene to Vitamin A.

The Board encourages further research to determine how the new variety may play a part in the ongoing global effort to fight vitamin A deficiency in poor countries. Vitamin A deficiency is the leading cause of preventable blindness in children.

According to the World Health Organization, dietary vitamin A deficiency (VAD) causes some 250,000 to 500,000 children to go blind each year. More than half those who lose their sight die within a year. VAD compromises the immune systems of approximately 40 percent of children under five in the developing world, greatly increasing the risk of severe illnesses from common childhood infections. VAD is most severe in Southeast Asia and Africa.

While the large beta-carotene increase in Golden Rice is an exciting advance, it is important to keep in mind that even with elevated levels of vitamin A, Golden Rice is not by itself a solution to malnutrition in developing countries. Malnutrition is rooted in political, economic and cultural issues that cannot be magically resolved by a single agricultural technology. Golden Rice offers developing countries another choice in the broader campaign against malnutrition.

This new development is further evidence that Golden Rice could complement existing efforts that seek to end blindness and other diseases caused by vitamin A deficiency. These other efforts include fortifying basic foodstuff with vitamin A, distributing vitamin A supplements, and increasing consumption of other foods rich in vitamin A. Golden Rice is but one tool in a larger toolbox from which country health officials, farmers and consumers could choose in their efforts to fight vitamin A deficiency.

No new or previous varieties of Golden Rice should be introduced for large-scale planting until independent scientific evaluations and government regulatory reviews have been conducted in countries where it might be cultivated. .

The new development increases the amount of beta-carotene, a substance found naturally in orange and yellow fruits and vegetables, in the new rice variety by incorporating a gene that produces a safe, naturally occurring enzyme found in corn.

In Asia, the average person eats rice two or three times a day. Three of the world's four most populous countries-China, India and Indonesia, which together have about 2.5 billion people-are considered "rice based societies." Rice also has become a staple food in many African countries.

Globally, rice grain is the world's most important source of human food-feeding more than half of the world's population. Rice is a good provider of calories and protein, but rice scientists have long recognized its micronutrient deficiencies. Milled white rice contains essentially no beta-carotene and unmilled brown rice contains a very small amount.

Public rice research institutions in the Philippines, Vietnam, India, Bangladesh, China and Indonesia are in various stages of leading efforts to develop locally adapted Golden Rice varieties.*

Once locally developed varieties containing the Golden trait have been cleared at the national level for biosafety, they will be made available to subsistence farmers free of charge. The seed will become their property and they will also be able to use part of their harvest for the next sowing, free of cost. Golden Rice is compatible with farmers using traditional farming systems, without the need for additional agronomic inputs. Therefore, no new dependencies will be created. Furthermore, the Golden traitÿ does not pose any known risk to the environment. The Humanitarian Board believes that social acceptance of Golden Rice is an important issue and must be addressed with and by partners in developing countries.

The Humanitarian Board is aware that as a genetically modified organism, Golden Rice will and should be given intensive scrutiny and that it also could be the subject of some controversy. Countries where Golden Rice could provide health benefits should be provided with the opportunity and information to pursue their own independent decision-making process and should not be pressured to either accept or reject Golden Rice.

Reaching the needy in target countries requires a highly professional and interdisciplinary team. For this purpose an honorary Humanitarian Board, composed of internationally recognised experts drawn from reputed institutions, is working closely with local groups in rice-based societies to help provide counsel on the continued discussions about and development of Golden Rice. The Humanitarian Board is chaired by Professor Ingo Potrykus, Professor emeritus, Swiss Federal Institute of Technology, and co-inveÿntor of Golden Rice, together with Professor Peter Beyer, University of Freiburg.

The Humanitarian Board is further composed of: Dr. Gurdev Khush, who was the principal rice breeder at the International Rice Research Institute in the Philippines for 23 years and is now affiliated with University of California Davis; Prof. Robert Russell, Director, Jean Mayer Human Nutrition Research Center on Aging, Tufts University, Boston; Dr. Howarth Bouis, Director of the HarvestPlus Challenge Program under the auspices of the International Center for Tropical Agriculture (CIAT), Colombia, and the Iÿnternational Food Policy Research Institute (IFPRI), Washington DC; Dr. Gary Toenniessen, Director of Food Security, The Rockefeller Foundation; Dr Robert Bertram, Chief, Multilateral Programs Division, Center for Economic Growth and Agricultural Development, Global Bureau, US Agency for International Development; Dr. Katharina Jenny, Senior Advisor Natural Resources and Environment Division, Swiss Agency for Development and Cooperation; Dr. Adrian Dubock, Biotechnology Ventures and Humanitarian Technologyÿ Donations, Syngenta; Dr. Ren Wang, Deputy Director General Research, and Dr. William Padolina, Deputy Director General Partnerships, both International Rice Research Institute, the Philippines.

*The Golden Rice Network

The Golden Rice Network, coordinated by Dr. Gerard Barry (IRRI), will be the primary beneficiaries of the technnology. The institutions involved are breeding the Golden trait into local varieties for smallholder farmers. Philippines International Rice Research Institute (IRRI) (Management) National Rice Research Institute (PhilRice) Vietnam Cuu Long Delta Rice Research Institute India Department of Biotechnology, India Directorate of Rice Research Indian Agricultural Research Institute University of Delhi South Campus Tamil Nadu Agricultural University Agricultural University, Patnagar University of Agricultural Sciences, Bangalore Chinsurah Rice Research Station Bangladesh Bangladesh Rice Research Institute China Huazhong Agricultural University Chinese Academy of Science Yunnan Academy of Agricultural Sciences Indonesia Agency for Agricultural Research & Development, Jakarta.
***************************************

Improving the nutritional value of Golden Rice through increased pro-vitamin A content

- NATURE BIOTECHNOLOGY, 27 March 2005

By Jacqueline A Paine, Catherine A Shipton, Sunandha Chaggar, Rhian M Howells, Mike J Kennedy, Gareth Vernon, Susan Y Wright, Edward Hinchliffe, Jessica L Adams, Aron L Silverstone & Rachel Drake

‘Golden Rice’ is a variety of rice engineered to produce bcarotene (pro-vitamin A) to help combat vitamin A deficiency1, and it has been predicted that its contribution to alleviating vitamin A deficiency would be substantially improved through even higher b-carotene content2. We hypothesized that the daffodil gene encoding phytoene synthase (psy), one of the two genes used to develop Golden Rice, was the limiting step in b-carotene accumulation. Through systematic testing of other plant psys, we identified a psy from maize that substantially increased carotenoid accumulation in a model plant system. We went on to develop ‘Golden Rice 2’ introducing this psy in combination with the Erwinia uredovora carotene desaturase (crtI) used to generate the original Golden Rice1. We observed an increase in total carotenoids of up to 23-fold (maximum 37 lg/g) compared to the original Golden Rice and a preferential accumulation of b-carotene.

Carotenoids are a group of plant pigments important in the human diet as the only precursors of vitamin A. Certain carotenoids, most importantly b-carotene, are cleaved to vitamin A within the body and are referred to as pro-vitamin A3. Vitamin A deficiency, a major problem in parts of the developing world, can result in permanent blindness and increase the incidence and severity of infectious diseases4. In Asia, vitamin A deficiency is associated with the povertyrelated predominant consumption of rice, which lacks pro-vitamin A in the edible part of the grain (endosperm). Providing pro-vitamin A in a staple food such as rice could be a simple and effective complement to supplementation programs5 because, through farming, it would be ubiquitous and self-sustaining.

Golden Rice is the name coined to describe the genetically modified rice1 that produces carotenoids in the endosperm of the grain, giving rise to a characteristic yellow color. In this pioneering work, a maximum level of 1.6 mg/g total carotenoids was achieved and has not been surpassed in subsequent experiments using alternative rice varieties6,7. The limited production of pro-vitamin A in Golden Rice is cited in the media as the major hurdle to the success of this particular solution for vitamin A deficiency.

Phytoene synthase is thought to be the limiting step for carotenoid biosynthesis in some wild-type tissues and is viewed as a major regulatory step8–10 (a pathway diagram is shown in Supplementary Fig. 1 online). This was the case in canola seed, where sole expression of crtB (the gene encoding a bacterial phytoene synthase) led to a substantial increase in carotenoid accumulation11. In wild-type rice endosperm, the first barriers to carotenoid biosynthesis are both phytoene synthase and carotene desaturase, which are provided by the daffodil psy and crtI transgenes in Golden Rice1. It is unknown what limits the further accumulation of carotenoid in Golden Rice. As no phytoene was accumulated (P. Beyer, University of Freiburg, personal communication), it appears that the desaturation of phytoene to lycopene is proceeding efficiently using the crtI gene product. We hypothesized that PSY may still be the limiting factor in this transgenic tissue. Daffodil PSY protein is known to be present at similarly high levels in both the Golden Rice endosperm and the daffodil petal12 which suggests either that it is insufficiently active or that an alternative PSY functionality is required to overcome it being the rate-limiting step in the transgenic material.

All tissues that accumulate high levels of carotenoid have a mechanism for carotenoid sequestration including crystallization, oil deposition, membrane proliferation or protein-lipid sequestration13. The noncarotenogenic starchy rice endosperm is very low in lipid and apparently lacks any such means for carotenoid deposition. This in itself may cap the carotenoid content of Golden Rice at its low level regardless of transgenic pathway capability14. Another restriction in Golden Rice could be precursor supply. We chose not to investigate these hypotheses initially and in the course of our work duly demonstrated that they are of no immediate concern.

We systematically tested psy cDNAs from alternative plant sources, particularly carotenoid-rich sources, with the aim of increasing the carotenoid content of Golden Rice. In an attempt to rank the suitability of the psys for use in rice, each was stably transformed into inherently carotenogenic maize callus15 (Fig. 1a). Marked differences in performance of the various psys were obvious in terms of both the absolute amounts of carotenoid produced and in the proportion of highly colored calli (Fig. 1b,c). Both of these measures were judged to be indicative of potential transgene efficacy. The most efficacious were maize psy16, with a high carotenoid content, and a novel rice psy (AJ715786, cloned for this work) with a high proportion of highly colored calli. Carrot psy (AB032797), tomato psy117, bell pepper psy118 and Arabidopsis thaliana psy19 were intermediate in efficacy. Daffodil psy20 performed least well.

Based on our psy rank obtained from the callus experiments, the maize, tomato, pepper and rice psy cDNAs were individually used to transform rice, each with the crtI gene (Fig. 2a). Daffodil psy was included as a reference. Transgenic T1 rice grains containing any of the five psy cDNAs (with crtI) were visibly yellow when polished, some with a distinctly orange hue (Fig. 2b). Polished, nontransgenic seeds were white. The amounts of carotenoid produced by the different psy transgenes varied (Fig. 2c) and were in general agreement with the grain color. Consistent with the rankings observed in callus (Fig. 1), the highest carotenoid content in the T1 seed was achieved using either the maize (14 mg/g) or rice (18 mg/g) psy cDNAs with the crtI gene (Table 1). The presence of the pepper or tomato psy cDNAs resulted in intermediate pigment content, whereas daffodil psy gave the lowest levels (1.2 mg/g). A number of events showing a 3:1 segregation of colored from white grain were progressed to the next generation (excluding rice and daffodil psy). Analysis of the T2 seed showed that the carotenogenic ability was stable and heritable for all psy cDNAs (Table 1), and high levels of carotenoids were again observed in seed from homozygous progeny containing the maize psy/crtI transgenes (over 16 mg/g). In some higher colored events, some seeds were more intensely colored than others. Plant phenotype, the weight of one hundred T1 seed and germination rates were similar for the transgenic events to those of the wild-type control plants for each of the different psy/crtI combinations (data not shown). There was no correlation between the number of T-DNA insertion sites (assessed by segregation ratio) and the carotenoid content. The presence of maize PSY and CRTI proteins was assessed by western blot analysis of transgenic endosperm and both were confirmed to be of the predicted size (Supplementary Fig. 2 online).

Altering the source of the psy transgene was shown to have a major impact on the callus carotenoid content as well as that of transgenic rice grains. All psy cDNAs proved more efficacious than the daffodil psy that was used in the original Golden Rice1 despite the latter’s involvement in extremely high carotenoid accumulation in its natural context and being from a monocot source. This proves the hypothesis that daffodil PSY itself is the barrier to even higher levels of carotenoid accumulation in Golden Rice. There was apparently no shortage of the precursor geranyl geranyl diphosphate and no problem with product sequestration. The limitation was overcome by providing PSY proteins from different species, which presumably have slightly differential functionality. Maybe the same would hold true in transgenic canola12, whereby switching the phytoene synthase source may result in even higher levels of carotenoid in the oil. Phytoene was not detected in the endosperm of any transgenic plants indicating that the crtI gene product is capable of desaturating all of the phytoene produced, even by the most efficacious PSYs. There is no evidence to suggest that the bacterial desaturase (CRTI) is rate-limiting for carotenoid biosynthesis in any of the transgenic rice produced in this study—this was the case only in callus (Supplementary Table 1 online).

The reasons for the differing efficacy of psy cDNAs from alternative sources are not obvious and further study would be necessary to satisfactorily explain this. Differences in transgene transcription are unlikely to be a primary factor because all the psy transgenes were expressed under the control of the same promoter in both maize callus and rice. Transgene expression itself may be influenced by the evolutionary relationships of the transgene source species. Since the ranking of the PSYs was maintained in both transgenic systems, an inherent property of the enzymes’ catalytic ability (e.g., kcat, KM) could be implicated. Given the high sequence similarity between these PSYs, any structural differences that account for varying efficacy are likely to be subtle. Perhaps not surprisingly, the two best performing PSY proteins (from rice and maize) are more similar to each other in primary sequence (89% identical) than to any of the other PSYs used in the study (and to other putative rice PSYs in the databases). Structure-function modeling based on the known structure of the related squalene synthase protein21 did not reveal convincing reasons for the differences (unpublished data, R. Vine, C.S., R.D.). It seems unlikely that cofactors are differentially limiting PSY function because any deficiencies would have to be mirrored in maize callus and rice endosperm. The maize psy gene is known to be involved in carotenoid generation in maize endosperm plastids22. Perhaps the similarity in organellar environment with rice endosperm amyloplasts provides this particular PSY enzyme with an optimal setting.

A very high proportion of b-carotene (80–90%) in the transgenic rice endosperm is associated here with the highest levels of carotenoid production. The increase in total carotenoid content brought about by the more highly effective psy genes is largely due to a preferential increase in b-carotene rather than a proportional increase in all carotenoids (Table 1). The same trend was observed in the callus model (Supplementary Table 1 online) and a similar phenomenon was seen in transgenic canola using crtB11. In contrast, increases in the amount of b-carotene in transgenic tomato were associated with a reduced total carotenoid content possibly because of feedback inhibition at the level of phytoene synthase activity23. A possible explanation for the high b-carotene levels we observed (Tables 1 and 2) might be that the downstream processing of carotenes to xanthophylls (Supplementary Fig. 1 online) does not keep pace with the rate of flux through the pathway when an efficacious PSY is expressed and as a consequence b-carotene accumulates. A further explanation is that the pathway endpoint may be influenced by sequestration, perhaps rendering b-carotene inaccessible to downstream hydroxylases. Lycopene (the product of crtI phytoene desaturase activity) was not observed upon analysis of the endosperm of any of the psy/crtI transgenic lines.

To develop a second generation Golden Rice (Golden Rice 2) that might be suitable for practical use, maize psy and crtI were transformed again on a larger scale into a different variety using an alternative to antibiotic selection (Fig. 2d). We selected events showing a high endosperm color and yellow:white T1 seed in a typical mendelian ratio of 3:1, indicative of a single TDNA insertion locus. The carotenoid content in the polished T2 seed of homozygous plants from these events ranged from 9 to 37 mg/g (Table 2), a range of phenotype being usual in a population of transgenic plants. This was even higher than had been seen in the earlier experiment (up to 16 mg/g) with the same very high proportion of b-carotene (see discussion above) and exceptionally low levels of xanthophylls (Table 2). The fact that several hundred primary transformants were generated, compared to 21 in the earlier experiment, will have increased the probability of seeing strong phenotypes. The difference in rice variety and growing environment could also contribute to differences in performance. It is, however, the carotenoid content achieved in Golden Rice 2 plants under field conditions, when the transgenes have been introduced by backcrossing into locally adapted varieties that is the ultimate determining factor in their contribution to the alleviation of vitamin A deficiency. Further research and development activities are required before these events could be released from regulations. As before, there was no evidence to suggest that plant phenotype, seed weight or germination was affected by the presence of the transgenes (data not shown). Again in some plants, several seeds were more highly colored than others, perhaps containing an estimated 2–3 times more carotenoid.

The Golden Rice 2 reported here has up to 37 mg/g carotenoid of which 31 mg/g is b-carotene. This increase in total carotenoid and proportion of b-carotene over the original Golden Rice promises a greater impact on vitamin A deficiency and related health issues. A value of 30 mg/g (25 mg/g b-carotene), however, is used here for calculations of impact for vitamin A deficiency, this number being chosen at this early stage as a moderate prediction of future performance. Definitive statements on the benefit of Golden Rice for the alleviation of vitamin A deficiency cannot be made. The vitamin A delivered and its impact on the body depends on several unquantified factors, including b-carotene uptake and conversion to vitamin A, as well as the amount of rice consumed by the individual. These factors are under rigorous investigation at present but for the time being only estimates are available. The symptoms and effects of vitamin A deficiency are most dramatic in children. Therefore, for the purpose of this estimate we have used the US recommended dietary allowance (RDA) for 1- to 3-year-old children (300 mg vitamin A24). It would also be reasonable to assume that an individual receives at least some vitamin A from the current diet. Based on a retinol equivalency ratio for b-carotene of 12:1 (ref. 24), 50% of the children’s RDA is delivered by 72 g of dry Golden Rice 2. This is likely to be an underestimate because b-carotene may prove to be more bioavailable from rice, a comparatively simple food matrix, than it is from fruits and vegetables upon which the equivalency ratio is based24. A typical child’s portion is about 60 g of rice and more than one portion is frequently consumed per day in regions where rice is a staple food.

To the author’s knowledge, this direct comparison of gene orthologues is unique in plant metabolic engineering. We used it to identify an effective means of increasing the pro-vitamin A content of Golden Rice. The Golden Rice 2 reported here should have a substantially improved impact on the alleviation of vitamin A deficiency. Our results support a new hypothesis that even in Golden Rice 2, expressing the efficacious maize psy/crtI transgene combination, phytoene synthase is still the limitation to yet higher levels of carotenoid.

METHODS

Humanitarian Project for Golden Rice.

Syngenta has no commercial interest in Golden Rice. The reported transgenic rice events are experimental. Consistent with Syngenta’s support of the Humanitarian Project for Golden Rice, Golden Rice 2 transgenic events will be donated for further research and development through license under certain conditions. Such conditions include being governed by the strategic direction of the Golden Rice Humanitarian Board and full regulatory compliance. Please direct requests to Adrian Dubock in the first instance (adrian.dubock@syngenta.com).

Cloning a novel rice psy gene.

A TBlastX similarity search against the rice genome25 using the Arabidopsis thaliana psy and rice psy (AY024351) genes identified genomic sequences of similarity in which genes were predicted using FGENESH algorithm with the monocot training set. Putative rice PSY sequences were aligned to several known plant PSY proteins using the CLUSTALW algorithm and one likely candidate was selected (now known as AJ715786). Total RNA was extracted from rice leaves (Asanohikari) using an RNeasy Mini kit (Qiagen) and polyA+ mRNA was purified using an Oligotex kit (Qiagen). RT-PCR of the rice psy was performed (Qiagen Omniscript RT kit) using the primers 5¢-CTGTCCATGGCGGCCATCACGCTCCT-3¢ and 5¢- CGTCGGCCTGCATGGCCCTACTTCTGGCTATTTCTCAGTG-3¢. Alignment of putative mature PSY proteins was performed using T-COFFEE Version_1.37 with default parameters, BLOSUM62 matrices and Gendoc 2.6.002 program, after removal of a putative transit peptide from each sequence ending with the amino acid aligning with Leu67 in the daffodil PSY protein.

Overexpression of psy genes in callus.

The accession numbers of all nucleotide sequences are given at the end of the Methods and any deviations in sequences noted. The psy coding sequences of pepper, daffodil, A. thaliana and tomato were obtained by PCR or restriction digestion from plasmid DNA. The carrot and maize psy coding sequences were obtained by RT-PCR and PCR. In all cases, the coding sequence was cloned without any untranslated regions. Using primers, an NcoI or KpnI site was added at the 5¢ end (incorporating or adjacent to the start codon, respectively) and a SfiI site at the 3¢ end. Each psy was transferred into a pUC-based vector containing the maize polyubiquitin (Ubi-1) promoter with intron and nos terminator. Cloning into the NcoI or KpnI, and SfiI site of the vector placed the coding sequence within 6 nucleotides downstream of the Ubi-1 promoter and upstream of nos. SSUcrtI is a functional fusion of the pea RUBISCO small subunit plastid transit peptide with Erwinia uredovora crtI26. The SSUcrtI expression plasmid was obtained by replacing the CaMV 35S promoter from pUCET41 with the Ubi-1 promoter at the HindIII/XbaI sites. A separate pUC-based vector contained the pat selectable marker gene (phosphino N-acetyl transferase) and the reporter gene gus (to assess cell viability), each under the control of the Ubi-1 promoter and nos terminator.

Transient expression in suspension cultures, protoplasts, endosperm, epidermis and leaf material from tobacco, maize, onion, rice and wheat failed to alter carotenoid accumulation within the time frame of the experiment. These experiments were abandoned in favor of maize callus, which relies on stable integration of the transgenes.

Black Mexican Sweetcorn callus was cotransformed with a psy and pat construct (Fig. 1a) in at least two separate experiments essentially as described15. The suspension cell medium had 2 mg/l 2,4-dichlorophenoxyacetic acid (2,4-D) without asparagine or thiamine. Transformed cells were selected on 1 mg/l Bialaphos (Duchefa) for one week, 5 mg/l for a further four weeks, and then 2 mg/l Bialaphos for B3 weeks until calli were large enough to analyze. PCR was used to identify surviving calli containing the desired carotenoid transgene(s). The numbers of transgenic calli analyzed for carotenoid content were 95, 51, 105, 112, 57, 36, 13 and 272 for daffodil, carrot, tomato, maize, pepper, A. thaliana and rice psy and the empty vector (pBluescript II SK–), respectively. Each transgenic callus was an individual transformation event. Cotransformation of psy with the crtI gene had no effect on phytoene, or carotenoid content or composition.

Constructs for plant transformation.

The SSUcrtI and psy coding sequences were cloned between the intron and terminator of a pUC-based plasmid containing the rice glutelin Glut01 (Glu) promoter (nucleotides 1568–2406), castor bean catalase intron27 and nos terminator. The resulting Glu::intron:: SSUcrtI::nos cassette was transferred to a Bin19-based binary vector containing the hpt marker gene (pJH0104h) under the control of the Ubi-1 promoter and nos terminator to create pJH0104hcrtI. The Glu::intron::psy::nos cassettes were then transferred to pJH0104hcrtI. Short linker sequences were used between the cassette components to facilitate cloning.

For Golden Rice 2, a Glu::SSUcrtI::nos cassette was transferred into a Bin19- based binary vector containing the E. coli phospho-mannose isomerase (PMI) marker gene28 under the control of the Ubi-1 promoter and nos terminator to create pNOV2115crtI. A Glu::psy::nos cassette with maize psy coding sequence was then transferred to pNOV2115crtI generating pSYN12424.

Rice transformation.

Rice transformation for the test of various psys was based on previous protocols29,30 using cultivar Asanohikari with the following modifications. Embryogenic calli of 3–4 mm were incubated with Agrobacterium tumefaciens, spread onto R2COMAS (R2 Micro salts, 1/2 R2 Macro salts, B5 vitamins, 20 g/l sucrose, 10 g/l glucose, 1 g/l casein hydrolysate, 2 mg/l 2,4-D, 100 mM acetosyringone, pH 5.2) and placed in the dark at 26 1C. After selection, surviving embryogenic calli were transferred to regeneration medium (1/2 N6 Macro, N6 Micro and vitamins, AA amino acids, 20 g/l sucrose, 1 g/l casein hydrolysate, 0.2 mg/l naphthyleneacetic acid, 1 mg//l kinetin, 50 mg/l hygromycin B, pH 5.8, gelrite 6 g/l) to form transgenic plantlets. The numbers of transgenic plants analyzed for seed color were 32, 37, 21, 36 and 31 for daffodil, tomato, maize, pepper and rice psy, respectively.

Transformation of cultivar Kaybonnet with pSYN12424 was performed as above with the following modifications. Embryogenic cultures were established from mature embryos on MS-CIM (4.3 g/l MS salts, 5 ml/l B5 vitamins 1; 30 g/l sucrose, 500 mg/l proline, 500 mg/l glutamine, 300 mg/l casein hydrolysate, 2 mg/l 2,4-D, pH 5.8, 3 g/l Phytagel). Inoculated calli were incubated at 22 1C for 2 d, transferred to MS-CIM with ticarcillin (400 mg/l) for 7 d, and then to mannose selection (MS-CIM with 17.5 g/l mannose, 5 g/l sucrose, 300 mg/l ticarcillin) for 5 weeks in the dark. Proliferating colonies were transferred to regeneration medium (MS-CIM with 0.5 mg/l IAA, 1 mg/l zeatin, 200 mg/l ticarcillin, 20 g/l mannose, 30 g/l sorbitol, no sucrose), grown in the dark for 14 d and then moved to light at 30 1C for 14 d. Shoots were transferred to Murashige & Skoog medium with 20 g/l sorbitol for 2 weeks and then to soil.

Rice cultivation and analysis.

For the experimental comparison of psy cDNAs from various sources, plants were glasshouse grown in the UK using supplementary lighting at 70% relative humidity, with a 16-h day, and day/night temperatures of 27/21 1C. Flowering was initiated by a short day (10 h) treatment for 3 weeks at 8 weeks after planting. Seed was harvested from fully ripened panicles and dried for 3 days at 30 1C before threshing (Wintersteiger Stationary Thresher LD350).

Golden Rice 2 plants were glasshouse grown in the US using supplementary lighting at 450% relative humidity, with a 13-h day, and day/night temperatures of 29/23 1C. Seed was dried as above at 38 1C.

The number of Golden Rice 2 primary transformants created with pSYN12424 was 619. Using a series of quantitative PCR analyses (data not shown), we retained events that were highly likely to contain a single-copy of the T-DNA although owing to inherent inaccuracies with this method a small proportion will have been incorrectly categorized. Of the retained events, 103 produced at least 100 seeds.

Carotenoid extraction and analysis.

All samples were analyzed in low light or darkness and on ice where possible. Rice seed were dehusked (TR-200 Electromotion rice husker, Kett) and polished for 1 min (Pearlest polisher, Kett). The yellow seed was homogenized to a fine powder using a Glen Creston 8000 Mixer/Mill (Spex Certiprep) equipped with a hardened tool steel vial set with a 9-mm stainless steel ball. Before organic extraction, a known amount of astaxanthin (Sigma) was added as an internal standard. Homogenized samples (approximately 0.5 g) were rehydrated using 1 ml water, agitated on a vortex for 3 s followed by a 10-min incubation period. Carotenoids were extracted twice in 6 ml acetone and once in 2 ml tert-butylmethylether (TBME) by 30 s agitation, 5 min incubation and centrifugation at 1,370g for 5 min. Callus samples were freeze-dried, weighed and extracted twice with 1 ml acetone using centrifugation at 16,060g and a 10-min incubation. Pooled supernatants were evaporated to dryness with a stream of nitrogen gas and then redissolved in 75 ml ethyl acetate. High performance liquid chromatography analysis was performed using an YMC C30 column (3.0 mm, Fisher Scientific) and a 6% min–1 gradient from methanol/H2O/TBME, 1.3 mM NH4 acetate (70:25:5 vol/vol) to methanol/H2O/TBME, 1.3mM NH4 acetate (7:3:90 vol/ vol). Elution of colored carotenoids was followed at 472 nm. Given the condensed run-time it was not possible to resolve phytoene and phytofluene. These two were followed together at 286 nm and are referred to in the text as phytoene. An acceptance criterion of recoveries for the internal standard was between 70% and 110% and a coefficient variation percentage of maximum 20% was used.

Accession numbers.

Accession numbers with any nucleotide substitutions and the coordinates used in this study follow: psy sequences: Arabidopsis thaliana (AF009954), Daucus carota (AB032797, nucleotide changes t642c, c1030t, a1059g, a1065g), Narcissus pseudonarcissus (X78814), Capsicum annuum (X68017), Oryza sativa (AJ715786), Lycopersicon esculentum (M84744), Zea mays psy (U32636 with nucleotide changes g117c, gc195cg, g372a, c529a, t753a, a769t, a798g, g819a, t927c, a1031c, or for pSYN12424 U32636, B73 allele a1031c). Other sequences: rice glutelin promoter (D00584 1568–2406), transit peptide of pea RUBISCO SSU (X00806), Erwinia uredovora crtI (D90087 with change a3992g, and in constructs for rice transformation except Golden Rice 2, the addition of GCGGCCGCC (NotI site) immediately downstream of the ATG start codon), phosphino N-acetyl transferase (X17220), gus (nucleotides 115–2115, X84105), hpt (V01499 with additional GGATCCGTCGACCTGCA GATCGTTCAAACATTTGGCAATAAAGTTTCTTAA at 3¢ end), PMI (M15380), maize polyubiquitin Ubi–1 promoter with intron (nucleotides 2–1993, S94464, with changes a160g, addition of c at 813, deletion of c at 1012), castor bean catalase intron (nucleotides 679–867, D21161, with nucleotide changes at 791–795 to CGTGT, at 847–860 to TTGATCATCTTGATA) and terminator regions of nos (nucleotides 1848–2100, V00087).

Note: Supplementary information is available on the Nature Biotechnology website.

ACKNOWLEDGMENTS

The authors would like to thank Will Parish, Erik Dunder, Dong Fang Chen and Annalisa Tiozzo for tissue culture, Karen Bacon and Fasica Woldeyes for plant growth, Melanie Watkins for plant assessment, Elek Bolygo for analytical advice, Ebun Eno-Amooquaye for western blot analysis, Keith Ward for advice on statistics and others who gave technical support to the research. We would also like to thank Peter Beyer, Lu Liu and John Ray for plasmids. We thank Peter Beyer for discussion on the manuscript.

COMPETING INTERESTS STATEMENT

The authors declare that they have no competing financial interests.

Received 30 July 2004; accepted 15 February 2005 Published online at http://www.nature.com/naturebiotechnology/

1. Ye, X. et al. Engineering the provitamin A (b-carotene) biosynthetic pathway into (carotenoid-free) rice endosperm. Science 287, 303–305 (2000).

2. Zimmerman, R. & Qaim, M. Potential health benefits of Golden Rice: a Philippines case study. Food Policy 29, 147–168 (2004).

3. Yeum, K.J. & Russell, R.M. Carotenoid bioavailability and bioconversion. Ann. Rev. Nutr. 22, 483–504 (2002).

4. West, K.P. Jr. & Darnton-Hill, I. Vitamin A deficiency. in Nutrition and health in developing countries (eds. Semba, R.D. & Bloem, M.W.) 267–306 (Humana Press, Totowa, NJ, 2001).

5. Dawe, D., Robertson, R. & Unnevehr, L. Golden Rice: what role could it play in alleviation of VAD? Food Policy 27, 541–560 (2002).

6. Datta, K. et al. Bioengineered ‘golden’ indica rice cultivars with b-carotene metabolism in the endosperm with hygromycin and mannose selection systems. Plant Biotechnol. J. 1, 81–90 (2003).

7. Hoa, T.T.C., Al-Babili, S., Schaub, P., Potrykus, I. & Beyer, P. Golden Indica and Japonica rice lines amenable to deregulation. Plant Physiol. 113, 161–169 (2003).

8. Fraser, P.D., Truesdale, M., Bird, C.R., Schuch, W. & Bramley, P.M. Carotenoid biosynthesis during tomato fruit development. Plant Physiol. 105, 405–413 (1994).

9. Ronen, G., Cohen, M., Zamir, D. & Hirschberg, J. Regulation of carotenoid biosynthesis during tomato fruit development: expression of the gene for lycopene epsilon-cyclase is down-regulated during ripening and is elevated in the mutant. Delta. Plant J. 17, 341–351 (1999).

10. Fraser, P.D. et al. Evaluation of transgenic tomato plants expressing an additional phytoene synthase in a fruit-specific manner. Proc. Natl. Acad. Sci. USA 99, 1092– 1097 (2002).

11. Shewmaker, C.K., Sheehy, J.A., Daley, M., Colburn, S. & Yang Ke, D. Seed-specific overexpression of phytoene synthase: increase in carotenoids and other metabolic effects. Plant J. 20, 401–412 (1999).

12.Burkhardt, P.K. et al. Transgenic rice (Oryza sativa) endosperm expressing daffodil (Narcissus pseudonarcissus) phytoene synthase accumulates phytoene, a key intermediate of provitamin A biosynthesis. Plant J. 11, 1071–1078 (1997).

13. Camara, B., Hugueney, P., Bouvier, F., Kuntz, M. & Moneger, R. Biochemistry and molecular biology of chromoplast development. Int. Rev. Cytol. 163, 175–247 (1995).

14. Rabbani, S., Beyer, P., Lintig, J., Hugueney, P. & Kleinig, H. Induced beta–carotene synthesis driven by triacylglycerol deposition in the unicellular alga Dunaliella bardawil. Plant Physiol. 116, 1239–1248 (1998).

15.Keappler, H.F., Somers, D.A., Rines, H.W. & Cockburn, A.F. Silicon carbide fibermediated stable transformation of plant cells. Theor. Appl. Genet. 84, 560–566 (1992).

16.Buckner, B., San Miguel, P., Janick-Buckner, D. & Bennetzen, J.L. The y1 gene of maize codes for phytoene synthase. Genetics 143, 479–488 (1996).

17.Bartley, G.E., Viitanen, P.V., Bacot, K.O. & Scolnik, P.A. A tomato gene expressed during fruit ripening encodes an enzyme of the carotenoid biosynthesis pathway. J. Biol. Chem. 267, 5036–5039 (1992).

18.Romer, S., Hugueney, P., Bouvier, F., Camara, B. & Kuntz, M. Expression of the genes encoding the early carotenoid biosynthetic enzymes in Capsicum annuum. Biochem. Biophys. Res. Commun. 196, 1414–1421 (1993).

19. Scolnik, P.A. & Bartley, G.E. Nucleotide sequence of an Arabidopsis cDNA for phytoene synthase. Plant Physiol. 104, 1471–1472 (1994).

20. Schledz, M. et al. Phytoene synthase from Narcissus pseudonarcissus: functional expression, galactolipid requirement, topological distribution in chromoplasts and induction during flowering. Plant J. 10, 781–792 (1996).

21. Pandit, J. et al. Crystal structure of human squalene synthase. A key enzyme in cholesterol biosynthesis. J. Biol. Chem. 275, 30610–30617 (2000).

22. Palaisa, K.A., Morgante, M., Williams, M. & Rafalski, A. Contrasting effects of selection on sequence diversity and linkage disequilibrium at two phytoene synthase loci. Plant Cell 15, 1795–1806 (2003).

23.Romer, S. et al. Elevation of the provitamin A content of transgenic tomato plants. Nat. Biotechnol. 18, 666–669 (2000).

24. Institute of Medicine Dietary Reference Intakes for Vitamin A, Vitamin K, Arsenic, Boron, Chromium, Copper, Iodine, Iron, Manganese, Molybdenum, Nickel, Silicon, Vanadium, and Zinc (National Academy Press, Washington, DC, 2001).

25.Goff, S.A. et al. A draft sequence of the rice genome (Oryza sativa L. ssp japonica). Science 296, 92–100 (2002).

26.Misawa, N. et al. Functional expression of the Erwinia uredovora carotenoid biosynthesis gene crtI in transgenic plants showing an increase of b-carotene biosynthesis activity and resistance to the bleaching herbicide norflurazon. Plant J. 4, 833–40 (1993).

27. Tanaka, A. et al. Enhancement of foreign gene expression by a dicot intron in rice but not in tobacco is correlated with an increased level of mRNA and an efficient splicing of the intron. Nuc. Acids Res. 18, 6767–6770 (1990).

28.Negrotto, D., Jolley, M., Beer, S., Wenck, A.R. & Hansen, G. The use of phosphomannose isomerase as a selectable marker to recover transgenic maize plants (Zea mays L.) via Agrobacterium transformation. Plant Cell Reports 19, 798–803 (2000).

29.Hiei, Y., Ohta, S., Komari, T. & Kumashiro, T. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J. 6, 271–282 (1994).

30. Zhang, J., Xu, R.-J., Elliott, M.C. & Chen,, D.-F. Agrobacterium-mediated transformation of elite japonica and indica rice varieties. Mol. Biotechnol. 8, 223–231 (1997).
*******************************

http://comment.independent.co.uk/letters/story.jsp?story=624221

Letter: Nature and GM crops

- THE INDEPENDENT, 28 March 2005

Sir: Your article on the impact of GM crops on wildlife (21 March) failed to address the complexity of the issue. The article gives the impression that the GM technology used to create hybrid crops harms the environment more than conventional farming does by being very successful in suppressing weeds needed by certain types of wildlife. In reality, the problem lies with the specific hybrids created by the large biotech companies and with current farming practices.

The creation of GM crops is a powerful and precise technology that can be a very effective tool in the hands of plant breeders to create hybrids that are resistant to diseases and environmental stresses such as parasites and droughts. The current wave of opposition to GM crops in Europe is partly due to the particular hybrids created by the biotech industry that do not present any advantage other than to increase the profits of these companies. The industry focuses its efforts on creating hybrids that are profit margin since a company can sell both the seeds and the accompanying weed killer. R&D should instead focus on creating GM hybrids that incorporate genes that provide natural resistance to specific threats, eliminating the need for excessive use of weed-killers.

Industrialised modern farming methods have fulfilled their purpose in times of need by increasing the volumes of agricultural produce while significantly lowering the production cost, but we now have the opportunity to revise them. Given that the developed world is not desperate to keep increasing the agricultural output, suitable GM crops can be used in sustainable farming practices where wildlife will be given the space to exist within farmed areas.

PANOS MOURYELAS, Manchester
**********************

http://www.timesonline.co.uk/newspaper/0,,176-1530243,00.html

Table talk

- THE SUNDAY TIMES, By AA Gill, March 27, 2005

On the back, it says: "Please contact us if you'd like this leaflet in braille." The financial wizard who okayed that has got all my money.

Moving on, can we just get the organic thing clear? Organic does not mean additive-free; it means some additives and not others. Organic does not mean your food hasn't been washed with chemicals, frozen or kept fresh with gas, or that it has not been flown around the world. Organic does not necessarily mean it is healthier, or will make you live longer; nor does it mean tastier, fresher, or in some way improved. Organically farmed fish is not necessarily better than wild fish. Organically reared animals di death is no less traumatic.

More importantly, organic does not mean that the people who picked, packed, sowed and slaughtered were treated fairly, paid properly, or were free from artificial exploitation. The Chinese workers who drowned in Morecambe Bay were picking organic cockles for a pittance. If you really want to feed the hunger in your conscience, buy Fairtrade.

So what does organic actually mean? Buggered if I know. It usually means more expensive. Whatever the original good intentions of the organic movement, their good name has been hijacked by supermarkets, bijoux delicatessens and agri-processors as a value-added designer label. Organic comes with its own basket of aspiration, snobbery, vanity and fear that retailers on tight margins can exploit. And what I mind most about it is that it has reinvigorated the old class distinction in food. There is them that h healthy, caring lunch. It is the belief that you can buy not only a clear conscience, but a colon that works like the log flume at Alton Towers.

In general, I applaud and agree with many of the aims of environmentally careful producers, but it is time we all admitted that the label "organic" has been polluted with cynicism, sentiment, sloppy sharp practice and lies to the point where it is intellectually and practically bankrupt. What organic actually means is less than nothing.

And it hasn't made anyone a better cook. I have a number of rules about living a carefree consumer life. First: never buy anything from a man in a straw boater. And second: never eat in an establishment with a pun in its name. Which brings us to Eat and Two Veg, a diner on Westbourne Grove, in Notting Hill (where else?). This is a vegetarian diner, a concept that comes on the same wish list as a crocheted condom and a Buddhist bodyguard.

At the bottom of the menu, there is a lot of small print about vegan alternatives, soya protein, sourcing the best ingredients from around the world, and the fact that they endeavour to use organic and GM-free. What they don't mention is that, while out scouring the globe for happy buns, they haven't managed to find an organic human who can cook worth a damn, or whose idea of service is doing much more than smiling and shrugging.

Mark this well. Because, to my mind, Eat and Two Veg is the worst restaurant in London. Not just for the food, which I thought was repellent, but because it comes with such airs and graces. It is one thing to be a crap caff, but to mitigate it with highfalutin intentions is beneath the swill bucket. The Blonde and I took CNN's Christiane Amanpour, mother of a five-year-old, and Laura Bailey, a breast-feeding vegetarian (she is not feeding a vegetable - it is a baby). Both of them have a motherly concern.

So, let's get to the food. "Crispy aromatic luck (this dish contains gluten)" - vegetable protein masquerading as Jemima Puddle-Duck - was weird and bogey-esque. A schnitzel ("crumbled protein escalope with sautéed spinach and a creamy wine and watercress sauce") made me gasp out loud. It was histrionically vile, a tough inner sole of undead flavour coated in sticky crumble with a puddle of bin juice. It devoutly made me wish I had never used the word inedible before, so I could take it out in all its pris the night. Worst of all was a "cheeseburger" - "our special blend of vegetable protein, herbs and spices on a sesame bun". This would have counted as an unfair artificial stimulant in a face-pulling competition. One mouthful had me girning like a toothless pensioner getting his prostate poked.

It's not just that this Frankenstein mushroom meat was vomitous, it's that it was cooked as if by Serbian dinner ladies working in an Albanian orphanage. What is the point of getting healthy organic whatever, only to manufacture it into chewable styrofoam and pretend it was once part of God's creation? Do you ever see butchers carving sheep's heads into a green salad? And when was the last time you were offered mince as pineapple, or bacon-style celery? We did all the jokes about cauliflower ears, beef ...

You can't even say that Eat and Two Veg is a slick, cynical exploitation of the frightened and faddish folk of Notting Hill. That has already been done by the organic supermarket Fresh & Wild. This place is just stupid. It is one of the few restaurants I have come across that doesn't seem to know, on a basic level, what food is or what it is for. How can a "classic" niçoise be made with marinated tofu and avocado? Forget the Ent sap of tofu: you don't put avocado in a niçoise. And "Chykn caesar salad"? It's a genetically modified word.

This place made me as angry about the abuse of food as I've ever been. These are far worse abuses than battery chickens, farrowing pens, crated veal, foie gras, whale hunting or ocelot napkins. Eat and Two Veg has simply dropped its nylon kecks and laid a textured vegetable curl on the plate of everybody who has ever tried to improve the quality, preparation and accountability of the food we eat. If I hadn't been responsibly out on your behalf, I would have refused to pay and offered them my credit card wo melons and a marrow.

This review is available in braille. On a cheese grater.
*********************************

http://www.omaha.com/index.php?u_np=0&u_pg=46&u_sid=1368816

NU-Monsanto seed deal criticized

- OMAHA WORLD-HERALD, Bill Hord, 25 March 2005

LINCOLN -- A University of Nebraska-Lincoln genetic breakthrough has led to a $2.5 million partnership with Monsanto Co. and to criticism from one university regent.

UNL researchers will receive up to $2.5 million from Monsanto over the next five years to develop soybean seeds that can withstand sprayings of a weedkiller known as dicamba.

The agreement, which also calls for royalty payments to the university after the seed goes to market, stems from genetic discoveries by UNL biochemist Don Weeks and other plant scientists.

University of Nebraska Regent Chuck Hassebrook of Lyons criticized the agreement Thursday, saying the university's research is helping Monsanto line its pockets.

"What we're doing is going to suck money out of rural Nebraska and put it into the corporate coffers in St. Louis," Hassebrook said. Monsanto is based in St. Louis.

Hassebrook said Monsanto sells its herbicide-resistant seeds at premium prices, including technology fees, and prohibits farmers from saving seed from their crops for future plantings.

"Monsanto makes more money, and farmers make less," said Hassebrook, executive director of the Center for Rural Affairs, a nonprofit organization that advocates for small family farms.

The university's breakthrough has the potential to help Monsanto develop a line of seeds that will work with dicamba, much the way that its Roundup Ready seeds have worked with glyphosate, which Monsanto markets as Roundup.

The Roundup seed-herbicide combination has been on the market long enough that some weeds have become tough to kill. In many cases, it takes more Roundup to zap the weeds than in the past.

Dicamba could come to the rescue, say some farmers.

"With the weeds getting a higher tolerance to Roundup, we will need other tools to help us control those weeds," said Lisa Lunz, who farms with her husband, Jim, near Wakefield. "This will be one of them."

Lunz is chairwoman of the research committee of the Nebraska Soybean Association. Even though private corporations profit from the research, she said, there doesn't seem to be an alternative.

"I'm thinking this product will be good for us," she said. "Will the technology fees be good for us? No."

Hassebrook said the university should focus on research that helps farmers manage their crops without the need for expensive technology fees.

"I think we should do work that would contribute to the common good of Nebraskans without enriching Monsanto at the expense of Nebraskans," he said.

Prem Paul, vice chancellor for research at UNL, said the university first sought funding from commodity groups for the research. It then sought proposals from several industry corporations before selecting Monsanto.

"What this is about is having a collaboration with a reputable corporate partner that has expertise and resources to bring this to the marketplace in a way that will benefit farmers and the general public," Paul said.
*******************************

GM minutiae

- THE CANBERRA TIMES, 28 March 2005

Bob Phelps's response (CT Letters, March 8) to our previous letter was completely unsurprising, given that he has shown himself to be unwilling to consider any benefits of agricultural biotechnology.

Mr Phelps attribution of Australia's mandatory labelling system for GM foods as a fanciful claim on our part is erroneous. Australia does have a mandatory labelling system for GM ingredients in food which is set out in the Australian Food Standards Code. The starches, oils and sugars that Mr Phelps mentions are exempt from being labelled because they are so highly refined that they do not contain any genetically modified DNA or novel proteins in the finished product.

We also note that Mr Phelps has changed his position regarding the L-tryptophan poisoning from stating that it was caused by GM bacteria to saying that it may have been caused by GM microbes. Perhaps if he considers the findings of the 2002 Report of the New Zealand Royal Commission on Genetic Modification, his opinion may change yet again.

While arguing about the labelling of highly processed products, Mr Phelps is ignoring the big picture. The aim of genetically modifying crops is to improve their quality, nutritional composition, yield, environmental impact and ease of production. In Australia, the planting of GM cotton, which requires fewer pesticide sprayings than conventional cotton, has reduced the amount of pesticide residue seeping into rivers and water tables and has reduced pesticide- related health problems among growers. Internat which will provide essential nutrients to the poor in developing countries and reduce mortality and illness levels.

Instead of just arguing about minutiae, Mr Phelps should also consider the potential that this technology can have in helping people all around the world in improving food security and reducing pesticide use.

Greg Bodulovic, Griffith Professor Barry Rolfe, Research School of Biological Sciences, ANU
**********************************

Food fight

- SHANGHAI DAILY, 28 March 2005

It has been reported that people cannot buy non-genetically-modified soybean oil in Beijing.

Beijing Youth Daily has discovered the domestic soybean supplies can not meet demand. Most imported soybeans are genetically modified. They are cheaper and produce more oil than domestic, non-GM soybeans.

For cost-sensitive producers, importing the ingredients is both inevitable and economical. The central government has created no laws limiting the use of genetically-modified ingredients. Therefore, no one can blame the producers.

On the other hand, the agricultural department in Beijing can't do much either. Officers say they can only punish producers who don't label products properly. They have no authority to ask companies to produce specific products.

The safety of GM food has always been controversial among scientists, product researchers, as well as consumers. Many other countries have strict regulations. Essentially they either limit the percentage of GM ingredients, or prohibit the import of GM foods.

China needs to treat the problem seriously. It is relatively easy to gather experts to hold hearings, leading to the development of a policy that encourages more non-GM soybean production. Even if GM foods are not banned, people deserve a choice of what goes into their mouths.
*************************************

http://www.financialexpress.com/fe_full_story.php?content_id=86349

Need for infrastructure to test imported GM food: government

- FINANCIAL EXPRESS, By ASHOK B SHARMA, March 28, 2005

NEW DELHI, MARCH 27: The government has noted the urgent need to develop adequate infrastructure for testing genetically modified (GM) food that are being clandestinely imported into the country. It has also decided to assess the baseline capacity for biosafety needs.

The situation has also become imperative as transgenics developed for as many as 13 crops in the country are undergoing contained limited field trials and multi-location trials and are waiting for approvals for commercial cultivation. There are over 22 transgenic food under various stages of research.

At present, there are guidelines in place for testing GM crops and seeds, but not for a finished product which may contain traces of genetically modified organisms (GMOs).

In this context, the government has waken up to the reports of clandestine imports of GM food. It has decided to identify and develop capacities for testing and certification of GM foods.

The two-day workshop on capacity building on biosafety organised by the Union ministry of environment and forests and the industry body, Biotech Consortium India Ltd, which concluded on March 24, also urged for revision of the Prevention of Food Adulteration Act to accommodate the concerns centering GM food. The guidelines for food safety should be in accordance with international norms. It was also decided to evaluate the cost to be incurred for labeling of GM food before taking a final decision on the is

However, Manan Bhatt, senior vice-president of the Bangalore-based private sector company, Avestha Gengraine Technologies, says that his organisation is the only in the country which is capable of detecting traces of GMOs in food. He said: "We have technologies to detect traces of GMOs in food. Occassionally, some importers ask us to conduct tests and we test their import consignments. If the customs department wants us to check food consignments at the points of entry, we are prepared to undertake this ex

The two-day workshop was aimed at preparing the country in capacity building for implementation of the Cartagena Protocol. India has ratified the protocol and is preparing to participate in the second meeting of parties (MoP-2) scheduled in the middle of the year in Montreal in Canada.

The workshop also called for monitoring of long-term impact of living modified organisms (LMOs) on biodiversity. It called for effective coordination among various stakeholders and agencies and private and public sector partnership. It had, however, made no specific reference to participation of NGOs as stakeholders.

The workshop called for transparency in evaluation of transgenic crops developed by both private and public sector institutes. It called for "commercialisation of approved events in exporting countries."

There are as many as 35 public sector institutes and universities and 18 private sector companies engaged in developing transgenic crops. The transgenic developed for 13 crops which are approved for contained limited field trials and multi-location trials are:

o Insect-resistant brinjal developed by Indian Agricultural Research Institute, Tamil Nadu Agriculture University and Maharashtra Hybrid Seed Company (Mahyco).

o Insect-resistant cotton developed by UAS, Dharwad, Ankur Seeds, JK Agri Genetics, Krishidhan Seeds, Mahyco, Nath Seeds, Rasi Seeds, Syngenta India, Nuziveedu Seeds, Mahendra Hybrid Seeds, Tulsi Seeds, Ganga Kaveri, Vikki's Agrotech, Pravardhan Seeds, Prabhat Agri Biotech and Ajeet Seeds.

o Insect-resistant cabbage developed by IARI and Mahyco.

o Insect-resistant cauliflower developed by Mahyco.

o Virus-resistant groundnut developed by Icrisat.

o Superior hybrid mustard, resistant to fungal attack, plants with high level of Beta carotene, tolerant to abiotic stress - developed by IARI, National Research Centre on Weed sciences, Jabalpur, ProAgro PGS India, TERI and University of Delhi South Campus.

o Insect-tolerant okra developed by Mahyco.

o Insect-tolerant potato enriched with protein developed by Central Potato Research Institute, Jawaharlal Nehru University (JNU) in collaboration with National Centre for Plant Genome Research.

o Transgenic rice resistant to lepidopteran pests, bacterial blight, sucking pests, fungal infection, insects and salt developed by the Directorate of Rice Research, Hyderabad, Osmania University, IARI, Mahyco, Madurai Kamaraj University, Tamil Nadu Agriculture University and MS Swaminathan Research Foundation.

o Transgenic pigeonpea resistant to fungal pathogens developed by ICRISAT, Mahyco.

o Insect resistant sorghum developed by Mahyco.

o Insect-resistant tobacco developed by Central Tobacco Research Institute.

o Transgenic tomato resistant to insects, fungal infection and virus developed by IARI, JNU in collaboration with NCPGR, Mahyco.

Apart from these there are 22 transgenic crops under various stages of research in the country. These are - two varieties of blackgram, brassica, brinjal, cabbage, cauliflower, chickpea, cotton, groundnut, muskmelon, mustard and rapeseeds, okra, pigeonpea, potato, rice, sorghum, sugarcane, sunflower, tobacco, tomato, watermelon and wheat.
*******************************

http://www.nytimes.com/2005/03/27/international/americas/27corn.html?

Science vs. Culture in Mexico's Corn Staple

- NEW YORK TIMES, By ELISABETH MALKIN, 27 March 2005

CAPULALPAM DE MENDEZ, Mexico -- This ancient Zapotec Indian town of whitewashed adobe houses and tiled roofs perched on a verdant slope of the western Sierra Madre could not be farther from the American laboratories where white-coated scientists create strains of genetically altered corn.

This is the birthplace of maize, where people took thousands of years to domesticate its wild ancestor, where pre-Hispanic myths describe it as a gift from the gods, and where cooks prepare it in dozens of ways to be served at every meal. So the discovery of genetically modified corn in the tiny plots here set off a national furor over what many here see as an assault by American agribusiness on the crop that is at the core of Mexico's identity.

''For us, maize is in everything: tamales, tacos, tortillas, pozole,'' said Miguel Ramirez, a local teacher who is active in community affairs. ''For us it's sacred.''

Then, radiating distrust of government assurances after a decade of free trade that has all but depopulated the Mexican countryside, he asked a familiar question here: ''What is the government doing to make us self-sufficient?''

The response was a controversial biosecurity law passed by the Mexican Congress in February, a step that has divided Mexico's scientists. The issue has also put Washington on alert, making it wary of any threat to the 5.5 million tons of corn that American farmers export to Mexico each year, more than to any other country except Japan.

After several years of study, a panel of international experts found that the risks to health, the environment and biodiversity from genetically modified corn were so far very limited. But after a public forum here in Oaxaca State, the panel gave special weight to social and cultural arguments about protecting corn. It recommended that Mexico reduce corn imports, clearly label transgenic corn and mill genetically modified corn as soon as it enters the country, to prevent farmers from planting it.

In the end, the Mexican government set aside the milling recommendation as too expensive, but the new law requires still unspecified labeling. Over all, imports of American corn, mostly for animal feed, have stayed steady.

The United States' response to the report was immediate and blistering. It called the report ''fundamentally flawed'' and argued that the recommendations did not flow from the panel's scientific conclusions and undercut provisions of the North American Free Trade Agreement. ''If implemented, these recommendations would unnecessarily limit Nafta farmers' access to high-quality U.S. corn exports, as well as the environmental benefits that biotech corn provides,'' a statement read.

The argument has exposed deeper chords that have been resonating here for two decades. At its center is a dispute over whether Mexico's embrace of free trade can coexist with age-old farming practices that form the fabric of rural life.

Like everyone here, Mr. Ramirez farms a small plot to put corn on his table. Following tradition, each household plants grain selected and saved from the previous year's crop. The practice has created a diversity of corn varieties, reflected in a palette of kernels from nearly white to wine red to blue-black, making Mexico a corn seed bank for the world.

One argument against the introduction of genetically altered corn here is the fear that cross-pollination with native varieties could alter the purity of those crops.

To many in Oaxaca, the transgenic corn that seeped in from the United States was the final insult from successive governments that have dismantled supports for uncompetitive peasant farming and embraced free trade. The impact has been enormous over the past generation, driving hundreds of thousands of Mexicans from rural areas, many of them to the United States for work. ''There is a systematic strategy to finish off the countryside,'' said Aldo Gonzalez, an advocate on farm issues from the town of Guelataÿo.

Scientists have echoed those concerns, saying the threat to the crop and to the rural population cannot be separated. ''The most important cause of the loss of genetic diversity to the maize varieties is the loss of people, their departure from the countryside for California, New York and Texas,'' said Jose Sarukhan, a respected professor of ecology at the National Autonomous University of Mexico who led the panel.

As Congress debated the biosecurity law, opposing sides marshaled their own evidence to support contradictory conclusions. The potential danger to corn -- and its special place in Mexican society -- remain a centerpiece of opposition to the law.

The law's supporters say genetically modified strains could increase yields for Mexico's flagging corn production. They argue that the law sets up safeguards to introduce genetically modified crops cautiously and monitor their effects.

But such promises carry little weight in Oaxaca.

After scientists found transgenic corn in the fields of these mountains in 2001, despite a 1998 ban on commercial planting, Mr. Ramirez, the local activist, and others here asked for a study of the issue. That led to formation of the study panel, which was set up by the Commission for Environmental Cooperation, a government-financed group that monitors the environmental effects of Nafta, and was made up of experts from Mexico, the United States, Canada and Britain.

The study concluded that the alien corn found here probably came from American food imports distributed in government stores for the poor and planted by local farmers.

One such farmer, Olga Toro Maldonado, said the new corn produced well the first year. But the grain she saved and planted the following year produced ''tiny, ugly little things.'' That is because she planted corn developed for the Great Plains. In the end, she said, ''we realized that it is better to have our own maize.''

The new law promises special rules to protect corn, gives the environmental ministry new power over whether to approve any transgenic crops and allows communities to set up zones that are free of transgenics. The ban on commercial planting is still in effect.
***************************************

http://www.timesonline.co.uk/article/0,,2-1537718,00.html

Named: the farmers who make hay by handouts

- Times Online, By Valerie Elliott, March 23, 2005

THE scale of handouts from Brussels that line the pockets of some of the country’s richest people, including the Queen and the Prince of Wales, was exposed for the first time yesterday.

The biggest landowners, including members of the Royal Family, a clutch of dukes, and agrifood companies, are able to pick up hefty amounts of cash under the Common Agricultural Policy (CAP).

Tate & Lyle topped the payments league with more than £127 million, while Farmcare Ltd, a subsidiary of the Co-operative Group, received the most in direct farm handouts. The company was paid a total of £2,601,757.

The Queen received £545,897 for farming interests on her Sandringham House and Windsor Castle estates, and the Prince of Wales received £134,938 for his Duchy of Cornwall estate and £90,527 for the Duchy Home Farm on his Highgrove estate.

The Duke of Westminster, ranked second in The Sunday Times Rich List, was also paid £448,472 for his 6,000-acre estate through Grosvenor Farms Ltd.

All the payments were made during the financial year 2003-04 — the most recent for which figures are available. This cash costs the taxpayer £3 billion and adds some £800 a year to the food bill of a family of four.

The biggest individual beneficiary appears to be Sir Richard Sutton on behalf of his Settled Estate with more than £1 million. Sir Richard, 66, received £1,117,139 for his 7,000-acre Benham estate, in Berkshire, and farmland in Lincolnshire.

According to the Rich List he is worth some £120 million and is ranked 321st richest in Britain. He was not available for comment last night.

It is understood, however, that his estate, like many landowners, last week attempted to block the disclosure of details of the payments.

The decision to expose the cash handouts was made by ministers at the Department for Environment, Food and Rural Affairs last week. They agreed to lift the lid on the payments after a request for the details under the Freedom of Information Act by The Times and other organisations. A CD-Rom listing 100,000 individual payments including 31p for an anonymous Mr Kelman was sent yesterday.

The decision has provoked uproar among farmers and landowners and hundreds contacted the Rural Payments Agency requesting that their details remained confidential.

Their anger has increased because the Scottish Executive and the Welsh Assembly were unable to release the cash payments made to their farmers after legal advice.

Under the rules the farmers who own the most land, keep the most farm animals and grow the most cereals receive the highest payments.

It is not surprising therefore that the leading dukes are all being paid six-figure cheques. The Duke of Marlborough, who owns Blenheim Palace and estate in Oxfordshire, receives £511,435 through the Blenheim Farm Partnership. The Duke of Richmond, who is ranked 865th in the Rich List and is worth £45 million, was paid £456,404 for his 12,000acre West Sussex estate through the Goodwood Estate Company. The estate is also home to Goodwood racecourse.

Oxfam said that the data vindicated its campaign to expose the fat cats in the payment system. Phil Bloomer, head of its Make Trade Fair campaign, said that big farmers are the winners from a system that fails everyone else.

“East Anglian grain barons and the landed gentry enjoy a bumper cash harvest while small British farmers struggle to get by. British taxpayers pay out more than £3 billion a year to support the CAP, which destroys poor farmers overseas by encouraging overproduction and dumping. It also damages the environment and hurts consumers through higher prices.”

#